108053

Sign In to show prices
SKU
KK-108053
More Information
Library KK
Construct Id 106906
Status available
VDRC Id 108053
CG Number (r6.01) CG1744
Synonyms 24B10
516
BSH
CHP
CT5040
Chaoptic
Chaoptin
Chp
MAb 24B10
MAb24B10
Mab24B10
Neural-specific-protein
Nsp
chaoptic
chaoptin
chp
mAB24B10
mAb 24B10
mAb24B10
FlyBase gene number FBgn0000313
Viability viable
Hairpin Length 334
ON Targets 1
OFF Targets 0
CAN Repeats 3
Inserted Chromosome 2
Insertion @ 40D Y
Left Primer PCR1 tggcgcccctagatgAGAGTGTGAATGGGATTGCC
Left Primer PCR2 GCGCGAATTCTGGCGCCCCTAGATG(ETU)
Right Primer PCR1 tagcctccctagcgcACCTGAGTGGGAACAACCTG
Right Primer PCR2 GCGCTCTAGATAGCCTCCCTAGCGC(XTS4)
Sequence Verification Primer ETU
Template genomic
Sequence AGAGTGTGAATGGGATTGCCATCGAAGAAGGTGCGGTTGACGGTATCGAAGTACTTGAATGAATTGGGAGGCAGGACCTCGATGTGATTGTACTCCAGGTGTAGATTGTCCAGATTCAGCTTGGTGCTGGCCTTGATCTCGTAGGTTTCGTTGCCACTGAGCGACCAGATCACATTGTGGGAGATATCTAGGGTGCGAAGGCTCTTTAGCGGACCCAGGGCGTCGTACGGAATCTCCGAGAGGATATTGTCCGTGAGCAACAGACGGGTCAGCCTCGGCATTCCATCGACGAACACATTCGGATCGATCTCGAACAGGTTGTTCCCACTCAGGT