108051

Sign In to show prices
SKU
KK-108051
More Information
Library KK
Construct Id 106821
Status available
VDRC Id 108051
CG Number (r6.01) CG18269
FlyBase gene number FBgn0031719
Viability viable
Hairpin Length 429
ON Targets 1
OFF Targets 0
CAN Repeats 2
Inserted Chromosome 2
Insertion @ 40D N
Left Primer PCR1 tggcgcccctagatgCGAGTGAAAAGGAGACGGAG
Left Primer PCR2 GCGCGAATTCTGGCGCCCCTAGATG(ETU)
Right Primer PCR1 cgacgcccgctgataTGGGTTTCTTGGAGGAGATG
Right Primer PCR2 GCGCTCTAGACGACGCCCGCTGATA(XTS1)
Sequence Verification Primer ETU
Template genomic
Sequence CGAGTGAAAAGGAGACGGAGGCGCCACTGAAGGAACAAGTGCTGGAGCCGCAGGAGATTGTCCCAAATTTATCGTTCCATTTGTTCAGCTATCGACAGCAAATGGGCAGCAAGAAGCACCAGTTGATGAAGTGGGCCACATCCAAGTTGGTACTCACCGAAGAGCTGCTCAAATTGCAAAGGCAACGACTGGCAGATACCAACGAGTCCTGGACCGATTTTGCATCCTTGTACGCGGACAAGGATGATGAGGAGAATCGTGAACCAAATGGTGACGATACATTAGTTCAGGAACTGAGCAACCTGAGAAACTATCGAATGGAATTGAGGGGCACCATTCTGGAGTTTGCCCAGGAGAAGATGAAGAAGCGAGAGAAGAAAAAGTTGAAGCGACTGAAACGACGCACCCTCATCTCCTCCAAGAAACCCA