100000

Sign In to show prices
SKU
KK-100000
More Information
Library KK
Construct Id 102886
Status available
VDRC Id 100000
CG Number (r6.01) CG5414
FlyBase gene number FBgn0036569
Viability viable
Hairpin Length 438
ON Targets 1
OFF Targets 0
CAN Repeats 2
Inserted Chromosome 2
Insertion @ 40D Y
Insertion @ 30B N
Left Primer PCR1 tggcgcccctagatgTCAGCTCTTATGGCGGACTT
Left Primer PCR2 GCGCGAATTCTGGCGCCCCTAGATG(ETU)
Right Primer PCR1 taggtctagccccgcCTGCTCACTGGCACGAATTA
Right Primer PCR2 GCGCTCTAGATAGGTCTAGCCCCGC(XTS2)
Sequence Verification Primer ETU
Template genomic
Sequence TCAGCTCTTATGGCGGACTTTGAGGCCAATACTCAGCTAAAGTGTGAGATAGTGCAGCACTTGAGTGGAGAATTATTGAGCAAGCTGAGCTATAATCATCCAATTGATAAAGAACAATCGAATCTGCCCTTTTTCGACGCCAGTCATGTGCAGGATAGCAAAGGTACGGGCCTGGTGCACACAGCTCCTGCCCATGGACCAGAAGATTTCCTTGTTAGTCTGACCCAGAAAATTCCTGTAAAGTGTTTTGTGAATGAGGAGGGCACTTACACCAAGGAAGCTCCTGATTTTCTACGCGGAAAATCAGTGTTGGATCAGGGAAATTCCCTAGTCCTCGACCGCATAGCAGAGGATGTAGTCCACTCCTCAAAGCTGGAACATTCCTATCCTATTGATTGGCGCACAAAAAAGCCTGTGATAATTCGTGCCAGTGAGCAG