330112

Sign In to show prices
SKU
SHRNA-330112

File(s)

There are no file attachments for this product.
More Information
Library shRNA
Construct Id 330112
Status available
VDRC Id 330112
CG Number (r6.01) CG4385
Sub-Category shRNA Stocks
Synonyms E(Raf)2B
EK2-2
ES2-4
EY2-4
Enhancer of GMR-sina 2-4
S
Star
Star/asteroid
floater
fltr
l(2)05671
l(2)07056
l(2)21Eb
l(2)c00080
l(2)k09538
l(2)rK134
lethal (2) c00080
star
FlyBase gene number FBgn0003310
FBgn0010102
FBgn0010674
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) ACGAGGAGACCTCGTGGTTCA
21bp Sequence (antisense) TGAACCACGAGGTCTCCTCGT
Sequence ctagcagtACGAGGAGACCTCGTGGTTCAtagttatattcaagcataTGAACCACGAGGTCTCCTCGTgcg