GD Stocks (GD)

GD
Shop By
Shopping Options
OFF Targets
  1. 0 8235item
  2. 1 2640item
  3. 2 776item
  4. 3 284item
  5. 4 156item
  6. 5 113item
  7. 6 75item
  8. 7 58item
  9. 8 45item
  10. 9 41item
  11. 10 39item
  12. 11 8item
  13. 12 15item
  14. 13 24item
  15. 14 19item
  16. 15 18item
  17. 16 14item
  18. 17 17item
  19. 18 4item
  20. 19 5item
  21. 20 7item
  22. 21 8item
  23. 22 5item
  24. 23 8item
  25. 24 10item
  26. 25 4item
  27. 26 8item
  28. 27 4item
  29. 28 1 item
  30. 29 2item
  31. 30 2item
  32. 31 2item
  33. 32 4item
  34. 33 3item
  35. 34 3item
  36. 35 2item
  37. 36 2item
  38. 37 4item
  39. 38 1 item
  40. 40 1 item
  41. 41 1 item
  42. 42 1 item
  43. 43 1 item
  44. 44 2item
  45. 45 2item
  46. 46 1 item
  47. 47 4item
  48. 48 4item
  49. 49 1 item
  50. 51 1 item
  51. 52 4item
  52. 55 1 item
  53. 56 4item
  54. 57 1 item
  55. 58 4item
  56. 60 1 item
  57. 61 1 item
  58. 62 1 item
  59. 63 1 item
  60. 64 1 item
  61. 69 2item
  62. 70 2item
  63. 71 7item
  64. 72 1 item
  65. 73 2item
  66. 75 1 item
  67. 76 1 item
  68. 78 2item
  69. 79 1 item
  70. 80 1 item
  71. 84 1 item
  72. 85 1 item
  73. 86 1 item
  74. 87 1 item
  75. 88 1 item
  76. 89 1 item
  77. 90 1 item
  78. 93 1 item
  79. 94 2item
  80. 95 4item
  81. 96 2item
  82. 99 1 item
  83. 102 5item
  84. 105 1 item
  85. 106 2item
  86. 109 1 item
  87. 112 1 item
  88. 113 1 item
  89. 114 1 item
  90. 119 1 item
  91. 121 1 item
  92. 122 1 item
  93. 126 1 item
  94. 127 2item
  95. 137 2item
  96. 138 1 item
  97. 143 1 item
  98. 144 1 item
  99. 145 1 item
  100. 146 2item
  101. 150 1 item
  102. 154 1 item
  103. 158 3item
  104. 159 1 item
  105. 160 2item
  106. 161 2item
  107. 162 1 item
  108. 163 1 item
  109. 167 1 item
  110. 171 1 item
  111. 173 3item
  112. 179 1 item
  113. 180 3item
  114. 181 1 item
  115. 182 1 item
  116. 203 2item
  117. 209 1 item
  118. 219 1 item
  119. 220 2item
  120. 223 1 item
  121. 224 1 item
  122. 225 1 item
  123. 226 3item
  124. 229 1 item
  125. 230 1 item
  126. 235 1 item
  127. 240 1 item
  128. 242 2item
  129. 245 1 item
  130. 249 1 item
  131. 250 1 item
  132. 259 1 item
  133. 261 2item
  134. 264 1 item
  135. 267 2item
  136. 269 1 item
  137. 271 1 item
  138. 274 1 item
  139. 282 1 item
  140. 287 1 item
  141. 288 1 item
  142. 289 2item
  143. 291 2item
  144. 292 1 item
  145. 296 1 item
  146. 306 1 item
  147. 310 2item
  148. 316 1 item
  149. 323 1 item
  150. 325 2item
  151. 327 1 item
  152. 333 2item
  153. 343 1 item
  154. 353 1 item
  155. 354 1 item
  156. 358 1 item
  157. 363 1 item
  158. 372 1 item
  159. 385 2item
  160. 391 1 item
  161. 400 2item
  162. 403 1 item
  163. 409 1 item
  164. 410 1 item
  165. 413 1 item
  166. 419 1 item
  167. 438 1 item
  168. 448 1 item
  169. 450 1 item
  170. 454 1 item
  171. 460 1 item
  172. 461 1 item
  173. 463 1 item
  174. 464 2item
  175. 466 1 item
  176. 470 1 item
  177. 471 1 item
  178. 474 1 item
  179. 475 1 item
  180. 476 1 item
  181. 484 1 item
  182. 492 1 item
  183. 494 1 item
  184. 498 1 item
  185. 505 1 item
  186. 506 1 item
  187. 508 1 item
  188. 520 1 item
  189. 530 1 item
  190. 538 1 item
  191. 540 1 item
  192. 545 1 item
  193. 548 1 item
  194. 551 1 item
  195. 564 1 item
  196. 565 1 item
  197. 579 1 item
  198. 582 1 item
  199. 584 1 item
  200. 587 1 item
  201. 591 1 item
  202. 593 1 item
  203. 602 1 item
  204. 610 1 item
  205. 611 1 item
  206. 623 1 item
  207. 626 1 item
  208. 633 2item
  209. 641 1 item
  210. 656 2item
  211. 659 1 item
  212. 669 1 item
  213. 673 1 item
  214. 677 1 item
  215. 680 1 item
  216. 683 1 item
  217. 686 1 item
  218. 705 1 item
  219. 713 1 item
  220. 716 1 item
  221. 725 1 item
  222. 754 1 item
  223. 764 1 item
  224. 773 1 item
  225. 783 2item
  226. 800 1 item
  227. 805 1 item
View as Grid List

Items 25-36 of 12920

Set Descending Direction
Name VDRC Id Library Sub-Category CG Number (r6.01) Genotype Construct Id FlyBase gene number Synonyms Left Primer Right Primer Hairpin Length Insertion Site Vector Template Sequence FlyBase Reference Reports RRID Comment Price (net) Add to Cart
2497
2497
GD
CG11562
782
BcDNA:RE44650
CGCGAATTCCGATGGTGTCCTGAGGGACGTT
CGCTCTAGAGCTATGTCAGTTGGCGGGCTTC
270
genomic
CGATGGTGTCCTGAGGGACGTTGAGCAGCAACAACGGCGCAAACACGAGAATACCTACACGCTGCAGCAGCAAATAGACATGACCAAGCAACTGAAAGCCAGGGAGGCGTCTAGCAACTCCTCTGACACGCCCGTACCTCCATCGACGCATCGCGCACAGAGTAATCTTCAAGCGGAGAAGCCAGCAGTGCAAAATGAAGGCGAGGCTTTCAGAGGTGTTCCTCAGGGTGGAACGACTAATCACGATGGAAGCCCGCCAACTGACATAGC
Sign In to show prices
2507
2507
GD
CG2789
788
anon-EST:Posey116
CGCGAATTCCTGATCGTCCGTGTGCTGGAA
CGCTCTAGATGTGCTGCCCGAAGAAAATGG
324
genomic
CTGATCGTCCGTGTGCTGGAAACATTCTCCGCATCGCCGGGGCCGTGATTCTGCCCAATCTGGGCGGCATCTATAACGGGCGGCTGACCAGGCAGCATCTCCAGAGCTGGTACGCCAACCTTAAGTTCCCGTCCTTCAAGCCGCCCAACTCGGTCTTTGCGCCGATGTGGATCTCCTTGTACGCGGGAATGGGCTACGGCTCCTACCTGGTGTGGCGTGATGGCGGAGGCTTCGCCGGCGAGGCGGCCAAACTGCCCCTGATCGCGTACGGCACCCAGCTGGCCTTGAACTGGGCGTGGACGCCCATTTTCTTCGGGCAGCACA
Sign In to show prices
2533
2533
GD
CG31663
815
BcDNA:GH27779
CG15359
CG15360
CGCGAATTCTGAGAAGTACGGCGGAGACTTTGG
CGCTCTAGAAGCACGAACAGGAAGCAAATGAATG
288
genomic
TGAGAAGTACGGCGGAGACTTTGGACGCGAGCGTCTGTTCTCCAGCATCGGAATGGCCATATTCTCTCCGATTACGGGCATCATGATTGATTATTCCTCGAGGGGCCTGGGATACACGGACTACTCGGCAGCCTTCTATACGTACGATGTTCTGCTGGTGATATCCACGATGTCGGTACTTATGATGCCTCTTGGCGAGAAACTGCCAGCCGACAATGTGTTCCGAGATCTGTGGAATCTCCTCAAGATGCCCCACGTGATTGCATTCATTTGCTTCCTGTTCGTGCT
Sign In to show prices
2541
2541
GD
CG4259
821
SPH173
CGCGAATTCGGGATACCTCGACTACGGCTGACC
CGCTCTAGAATGCCTTCCAGACCTTTCCCACA
346
genomic
GGGATACCTCGACTACGGCTGACCAGCAGCACGTGGATCTCGAGGTGCTGAATATAGTCTCCCATGAACAGTTCAACAGATTCAATGCCGAAAACAACATGGCGTTACTCATTCTGGTATCCGCATTTGAGATGACAGCCAACATTAATTTAATCCCATTGTACCTACAAGAAGCTGGTATTCAAAAAGGATCCTGCTTCTTCAACGGCTGGGGAAAAGTATATTTGAACTCGACGGACTACCCCACCGTTCTCAAGACGGTCCAGGTCGATCTTTTGAGCATGGGTATGTGTAGCTCTCGAAAGCTGCCCATCCAGCAAATCTGTGGGAAAGGTCTGGAAGGCAT
serrate
Sign In to show prices
2544
2544
GD
CG7263
822
AIF
Apoptosis Inducing Factor
Apoptosis inducing factor
DmAIF
SD03428p
aif
CGCGAATTCGTCATCCCCAACGCCAGCAT
CGCTCTAGAGCCAGCCGACCAGAGACCAC
308
genomic
GTCATCCCCAACGCCAGCATTCGCTCGGCAGTTCGCGATGAAACCAATCTAAAGTTGGAGTTAAACAATGGAATGACTTTGATGTCGGACGTGGTGGTGGTCTGCGTGGGTTGCACGCCAAACACGGATCTCGCGGGACCCAGCAGGCTAGAGGTGGACAGAAGTCTCGGCGGTTTTGTGGTTAATGCAGAGCTGGAGGCCAGGCGGAACCTGTACGTGGCCGGTGATGCTTCCTGCTTCTTCGATCCTCTGCTGGGCAGGCGACGGGTGGAGCACCATGATCACTCGGTGGTCTCTGGTCGGCTGGC
Sign In to show prices
2548
2548
GD
CG31668
823
CG10879
CG31668-PB
dSLC5A12
CGCGAATTCGAAGGTCTTGTGCGCGGAGGT
CGCTCTAGACATGGAATATGAGTAACCCCAAATAGCAGAG
256
genomic
GAAGGTCTTGTGCGCGGAGGTCGTCTGATATTTAGCGAGACCAATCCCTCGCCCTTTGCTCGTCACACCGTTTGGAGCGTTGTCATCGGCAACACCTTCTACTGGACCTCACTGAATGCGGTGCACCAGACCGTGGTTCATCGGTATATGTCCTTGCCCACTCTGAAGATGGCACGAGCCTCCATCGCCTTCCTTGTAGTTGGAGCTGCCTTCTTTATTTCACTTCTCTGCTATTTGGGGTTACTCATATTCCATG
Sign In to show prices
2552
2552
GD
CG33124
824
CG10879
CG33124-PB
dSLC5A13
CGCGAATTCTGCCTCCGTTGTGGTTGTGG
CGCTCTAGAGATGAGCAGTCCCAAGAAGCTGAGAA
313
genomic
TGCCTCCGTTGTGGTTGTGGCCATTCTGGCCACCTGCTACATCACCGACCTAGATGACTTCTTCGAAAGCCTGGTGGACGGCGGACGCCTCATATTTGGCAACATCAATCCCTCGCCGTATGTGCGCAATACGGTTTGGAGCGTGGTGATCGGCGGCGCTTTCTACTGGACCTCGATTACGGCGGTGCACCAGACTATGGTGCATCGCTACATGTCCTTGCCCAACTTAAAAATGGCCAGGACTTCCATTGCCTTTTTTGTCCTCGGATCGATCATCTTTTACTCGGTTCTCAGCTTCTTGGGACTGCTCATC
Sign In to show prices
2554
2554
GD
CG7082
828
PAPI
Partner of PIWIs
cg7082
papi
CGCGAATTCCGCCCGTGGTGAAAGTGGAA
CGCTCTAGACGCAATGCTGTTGGTGGGAGA
293
genomic
CGCCCGTGGTGAAAGTGGAACTGCAGGTGCCCCAGAGGCTGGCCAGCAAAATTAACGGACGCGGCGGCGAGCTCCTCCAGGAGATCCGGAGCAGTTCGCTAGCCAAGCTGAATATCGATTTAAATGGGCGGAATGGAAAGGCCAAGATTACGATTATCGGCAATCAAAAGCAAGTGAACATAGCCCGAAAAATGCTGGATGATCAGATAGAGGAGGATGAGGAACTCGTGCGGTCCATGGAGGAGGTGGAACAGCGTCGGGAGCCCCGCAGATCTCCCACCAACAGCATTGCG
Sign In to show prices
2558
2558
GD
CG17284
758
DmelObp93a
Obp93a
Odorant-binding protein 93a
CGCGAATTCGAAGCGGGTGCAGGAGTTCCAATG
CGCTCTAGACTTATTACTGGCCACATCATCACAGGC
187
genomic
GAAGCGGGTGCAGGAGTTCCAATGGATGCCCAAGAAGGGCGACTGCGACTTCTATCCTGCCACCTTGCTGGCCTGCGTCATGGAAAAGGTCTACATCAACTGCCCGACCAGCAAATGGAAAAACACCAGCGATTGCACAGCGATGTGGAAATATTTGGTTGCCTGTGATGATGTGGCCAGTAATAAG
Sign In to show prices
2560
2560
GD
CG16724
764
Dmtra
TRA
Tra
Transformer
tra
transformer
CGCGAATTCTCAAGCGAGAGGGACAGCAGAAA
CGCTCTAGAGTCTTTGGCGGAGGATTATACCGATG
310
genomic
TCAAGCGAGAGGGACAGCAGAAAGAAGGAGCACAAGATTCCGTACTTTGCAGACGAGGTTCGAGAACAGGATCGGTTGAGAAGATTGCGCCAAAGAGCGCACCAATCCACCAGACGCACTCGCTCCAGATCCAGATCACAGTCGTCCATCAGAGAGAGCAGGCACAGAAGGCATCGCCAGCGCTCTAGGAGCCGCAATCGCAACCGAAGTCGCAGCAGTGAACGAAAACGCCGTCAACATAGCCGAAGTCGCAGCAGTGAACGAAGACGCCGTCAACGGAGCCCGCATCGGTATAATCCTCCGCCAAAGA
Sign In to show prices
2561
2561
GD
CG16724
764
Dmtra
TRA
Tra
Transformer
tra
transformer
CGCGAATTCTCAAGCGAGAGGGACAGCAGAAA
CGCTCTAGAGTCTTTGGCGGAGGATTATACCGATG
310
genomic
TCAAGCGAGAGGGACAGCAGAAAGAAGGAGCACAAGATTCCGTACTTTGCAGACGAGGTTCGAGAACAGGATCGGTTGAGAAGATTGCGCCAAAGAGCGCACCAATCCACCAGACGCACTCGCTCCAGATCCAGATCACAGTCGTCCATCAGAGAGAGCAGGCACAGAAGGCATCGCCAGCGCTCTAGGAGCCGCAATCGCAACCGAAGTCGCAGCAGTGAACGAAAACGCCGTCAACATAGCCGAAGTCGCAGCAGTGAACGAAGACGCCGTCAACGGAGCCCGCATCGGTATAATCCTCCGCCAAAGA
only one cross
Sign In to show prices
2566
2566
GD
CG4267
831
CG31686
Dmel_CG4267
CGCGAATTCAACCAGCGTTAGCTTTGGCTTCG
CGCTCTAGATGGCATAGGGTGGCTTTGAGTAGGT
296
genomic
AACCAGCGTTAGCTTTGGCTTCGAGCAGCCCGTGGGACACGCCACCTTCTATCCCAACTATGGGAAGAATCAGAAGAAATGCTATGTCTATGGCTGTTCTCATAAGAGATCCCATGACTACTTCATAGAGTCGCTGACGAGTCCGGCGGGATTTTGGGGACCGCGCTGCGAGCGTCACGATGATGGCACCTGGCTGCTCCTAATGAGCGATGGAGAGTTCCGGATGGGCGGGGAGCCCTCAATCCCCAAGAACGGAACTTTCTATGTGAAAACCTACTCAAAGCCACCCTATGCCA
partly red eye/young flies almost white eyes
Sign In to show prices