dna3494

Sign In to show prices
SKU
GD-DNA-DNA3494

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 3494
Status available
VDRC Id dna3494
CG Number (r6.01) CG1380
Synonyms sugar transporter 4
sut4
FlyBase gene number FBgn0028560
Hairpin Length 353
ON Targets 1
OFF Targets 0
CAN Repeats 3
Left Primer CGCGAATTCGCTAATCCTGCTGCCACCGTTCT
Right Primer CGCTCTAGACCTTCTCGGCTTTTCCCTTTTGG
Template genomic
Sequence GCTAATCCTGCTGCCACCGTTCTTTATCGGATGGCTCCTGATCCTCCTGGCATCGCACATAGCAATGCTGCTGCTCGGACGCTTCGTAGTGGGATTCTGCGGAGGAGCCTTCTGCGTGACTTGTCCCATGTACGTGACTGAGATAGCCCAGGTCCAGTACCGCGGAACCATGGGATGCTTCTTCCAGCTGCTAATCGTTTTTGGTATTCTGTACGCCTTTGTGGTTGGAGGTTTTGTAAAGACCTTCTACTTTAATATTGCTTGCGCAATTTTGCCCGTAATCTTTTTTGTCTTGATGATTTTTATGCCGGAATCTCCGATTTTTCTGGCCCAAAAGGGAAAAGCCGAGAAGG