dna3488

Sign In to show prices
SKU
GD-DNA-DNA3488

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 3488
Status available
VDRC Id dna3488
CG Number (r6.01) CG13743
FlyBase gene number FBgn0033368
Hairpin Length 306
ON Targets 1
OFF Targets 540
CAN Repeats 8
Left Primer CGCGAATTCCAACCATCAGACACATCAGCAACAGG
Right Primer CGCTCTAGAATCAGGATGAGTGAGTAGTCGGTGATGTAGG
Template genomic
Sequence CAACCATCAGACACATCAGCAACAGGGCCAGCCGCAACAGCCACATCAGCAGCAGCAGCAGCCGCCGCAGCAGCAGCAGCAGCAACAGCATCGCCAGCATTCGCAGCAGCAGCAGCAAGCACAGCAGGATGCCGGACTGGGGGACACGCTGTCCTCGCTGCCACAGGCCTCGTTCAACTACATCAACTCCATCGTGGGCAGCGGCGTCATCGGCATACCCTACGCCCTTCACAGGGCCGGATTCGGACTGGGCCTGGCCCTGCTCATCCTGGTGGCCTACATCACCGACTACTCACTCATCCTGAT